Announcement : SignalChem has changed its corporate name from “SignalChem Pharmaceutical Inc.” to “SignalChem Biotech Inc.” effective March 20th 2019.
DNMT Substrate-1 (D53-58)

DNMT Substrate-1 (D53-58)

  • $105.00


FOR BULK ORDER REQUESTS PLEASE CONTACT US

Description : The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).

Storage, Stability and Shipping : Store product at -20oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles.

Applications : DNA methyltransferase assay (50pmole per reaction).

Molecular Weight : The size of double-stranded oligonucleotide is 34 base pairs. The molecular weight is 20891.54.

Format : White to off-white lyophilized powder.

Product Sheets: (by Lot #):

O1051-2.pdf

Research Areas : Apoptosis/Autophagy, Cancer, Cell Cycle, Neurobiology,